pet 22b vector novagen (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pet 22b vector novagen
Pet 22b Vector Novagen, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet+22b+vector+novagen/pCB98+(Plasmid+%2369744)/pm40349345-168-31-43
Average 93 stars, based on 4 article reviews
Pet 22b Vector Novagen, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet+22b+vector+novagen/pCB98+(Plasmid+%2369744)/pm40349345-168-31-43
Average 93 stars, based on 4 article reviews
pet 22b vector novagen - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Software:Article Title: Condensation-dependent multivalent interactions of EB1 and CENP-R regulate chromosome oscillations in mitosis. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Opti-MEM Gibco Cat#31985070 SIM SF medium Sino Biological Inc. MSF1 Trypsin Gibco Cat#25200072 Protease inhibitor cocktail for bacteria Sigma-Aldrich Cat#P8849 Protease inhibitor cocktail for mammalian cells Sigma-Aldrich Cat#P8340 FLAG-M2 resin Sigma-Aldrich Cat#A2220 GST resin Sigma-Aldrich Cat#70541 Ni-NTA resin QIAGEN Cat#30230 DyLight 488 NHS-Ester ThermoFisher Cat#1860502 PEG 4000 BBI Life Sciences Cat#PB0431 Tris(2-carboxyethyl) phosphine hydrochloride Macklin Inc. Cat#T819166 Deposited data NMR raw data This paper BMRB: 52975 Experimental models: Cell lines HeLa ATCC Cat#CCL-2 HEK293T ATCC Cat#CRL-11268 COS7 ATCC Cat#CRL-1651 SF9 ATCC Cat#CRL-1711 CENP-A-miniAID-EGFP endogenous knock-in HeLa cell line This paper N/A HeLa cell line stably expressing mCherry-H2B This paper N/A HEK293T cell line stably expressing 3xFLAG-EB1 This paper N/A Oligonucleotides EB1 shRNA: 50-AAGTGAAATTCCAAGCTAAGC-30 This paper N/A CENP-R shRNA: 50-CGTCATCTTGACAGCTATGAA-30 This paper N/A CENP-A sgRNA: 50- CTGACAGAAACACTGGGTGC -30 This paper N/A Recombinant DNA pET-22b-EB1-mCherry-63His This paper N/A pET-28a-63His-mCherry-CENP-R This paper N/A pET-28a-63His-mCherry-CENP-R12G This paper N/A pET-28a-63His-mCherry-CENP-RMut This paper N/A pET-28a-MBP-CENP-R This paper N/A pET-28a-MBP-CENP-R12G This paper N/A pET-28a-MBP-CENP-RMut This paper N/A pACEBac1-CENP-O-CENP-P-CENPQ-C6H-pIDC-CENP-U Zang Lab (Tian et al.7) N/A pFastBac1-CENP-R Zang Lab (Tian et al.7) N/A pFastBac1-CENP-R12G This paper N/A p33FLAG-CENP-R This paper N/A pEGFP-C1-sfGFP-CENP-R This paper N/A pEGFP-C1-sfGFP-CENP-R12G This paper N/A pEGFP-C1-sfGFP-CENP-R3G This paper N/A pEGFP-N3-EB1-mScarlet This paper N/A pHR-CENP-R-mCherry-Cry2 This paper N/A pHR-CENP-R12G-mCherry-Cry2 This paper N/A pLVX-mCherry-H2B This paper N/A pLVX-33FLAG-EB1 This paper N/A pLKO.1-shEB1 This paper N/A (Continued on next page) Cell Reports 44, 115560, May 27, 2025 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER pLKO.1-shCENP-R This paper N/A pLKO.1-shEB1-EB1-mCherry This paper N/A pLKO.1-shEB1-EB1KR6Q-mCherry This paper N/A pLKO.1-shCENP-R-CENP-R-mCherry This paper N/A pLKO.1-shCENP-R-CENP-R12G-mCherry This |